Review



pgex 6p 1 stu2  (Addgene inc)


Bioz Verified Symbol Addgene inc is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 91

    Structured Review

    Addgene inc pgex 6p 1 stu2
    Pgex 6p 1 Stu2, supplied by Addgene inc, used in various techniques. Bioz Stars score: 91/100, based on 4 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pgex 6p 1 stu2/product/Addgene inc
    Average 91 stars, based on 4 article reviews
    pgex 6p 1 stu2 - by Bioz Stars, 2026-05
    91/100 stars

    Images



    Similar Products

    91
    Addgene inc pgex 6p 1 stu2
    Pgex 6p 1 Stu2, supplied by Addgene inc, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pgex 6p 1 stu2/product/Addgene inc
    Average 91 stars, based on 1 article reviews
    pgex 6p 1 stu2 - by Bioz Stars, 2026-05
    91/100 stars
      Buy from Supplier

    93
    Addgene inc pgex 6p 1 gst plasmid
    Pgex 6p 1 Gst Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pgex 6p 1 gst plasmid/product/Addgene inc
    Average 93 stars, based on 1 article reviews
    pgex 6p 1 gst plasmid - by Bioz Stars, 2026-05
    93/100 stars
      Buy from Supplier

    93
    Addgene inc ttgaacctgatctccatcca n a n a recombinant dna pca24n nbrp rrid ncbitaxon 146876 pcp20 cgsc cgsc
    Ttgaacctgatctccatcca N A N A Recombinant Dna Pca24n Nbrp Rrid Ncbitaxon 146876 Pcp20 Cgsc Cgsc, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/ttgaacctgatctccatcca n a n a recombinant dna pca24n nbrp rrid ncbitaxon 146876 pcp20 cgsc cgsc/product/Addgene inc
    Average 93 stars, based on 1 article reviews
    ttgaacctgatctccatcca n a n a recombinant dna pca24n nbrp rrid ncbitaxon 146876 pcp20 cgsc cgsc - by Bioz Stars, 2026-05
    93/100 stars
      Buy from Supplier

    93
    Addgene inc pgex 6p 1
    Pgex 6p 1, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pgex 6p 1/product/Addgene inc
    Average 93 stars, based on 1 article reviews
    pgex 6p 1 - by Bioz Stars, 2026-05
    93/100 stars
      Buy from Supplier

    90
    Addgene inc pgex 6p 1 gst prmt2
    Pgex 6p 1 Gst Prmt2, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pgex 6p 1 gst prmt2/product/Addgene inc
    Average 90 stars, based on 1 article reviews
    pgex 6p 1 gst prmt2 - by Bioz Stars, 2026-05
    90/100 stars
      Buy from Supplier

    91
    Addgene inc pgex 6p 1 gst rh mnase
    Pgex 6p 1 Gst Rh Mnase, supplied by Addgene inc, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pgex 6p 1 gst rh mnase/product/Addgene inc
    Average 91 stars, based on 1 article reviews
    pgex 6p 1 gst rh mnase - by Bioz Stars, 2026-05
    91/100 stars
      Buy from Supplier

    90
    Addgene inc pgex sesn2
    Pgex Sesn2, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pgex sesn2/product/Addgene inc
    Average 90 stars, based on 1 article reviews
    pgex sesn2 - by Bioz Stars, 2026-05
    90/100 stars
      Buy from Supplier

    93
    Addgene inc human p300
    FIGURE 1 | Generation of a <t>p300</t> construct with improved yield. (A) Representative expression and purification gel of p300 KAT from pETdu- et+p300 KAT suggests a total yield of ~1 mg/L of media. Lanes show (1) Whole cell lysate (2) Insoluble pellet (3) Soluble supernatant (4) NiNTA flowthrough (5) Low salt (150 mM) wash (6) High salt (1 M) wash (7) NiNTA elution alongside the protein standard ladder lane (L) (ThermoFischer 26 634). p300 KAT is the faint band ~50 kDa in lane 7. (B) Schematic representation of the histone H4 (1-25)W construct used in subsequent experi- ments. This construct can be uniformly acetylated by p300 KAT on each of its five available lysine sites. (C) Demonstration of variable activity be- tween p300 KAT preparations shown by MALDI-MS spectra of identical acetylation reactions using presumably equivalent enzyme preparations. (D) Representative expression and purification gel for p300 KAT from pET His6 MBP TEV p300(1284–1669) LIC (Addgene #233587). Total yield was typ- ically > 10 mg/L of media. Lanes show (1) Whole cell lysate (2) Insoluble pellet (3) Soluble supernatant (4) NiNTA flowthrough 1 (5) Low salt (150 mM) wash (6) High salt (1 M) wash (7) NiNTA elution 1 (8) TEV protease dialysate (9) NiNTA flowthrough 2 (10) NiNTA wash 2 (11) NiNTA elution 2 (12) Protein ladder (NEB P7719S). Cleaved p300 KAT is the band ~43 kDa in lanes 9 and 10 (expected molecular weight once cleaved is 44 684 Da). Note this is very close to the expected molecular weight of 41 584 Da for the cleaved MBP solubility tag.
    Human P300, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/human p300/product/Addgene inc
    Average 93 stars, based on 1 article reviews
    human p300 - by Bioz Stars, 2026-05
    93/100 stars
      Buy from Supplier

    92
    Addgene inc plasmid pgex 6p 1 brd4 full length
    (a) Cryo-EM map and (b) cartoon representation of the <t>BRD4-S/nucleosome</t> complex showing how the <t>BRD4</t> BD1 (pink) interacts with the nucleosome. The modeled histone H4 tail residues 11-16 are shown as a thicker gold line.
    Plasmid Pgex 6p 1 Brd4 Full Length, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/plasmid pgex 6p 1 brd4 full length/product/Addgene inc
    Average 92 stars, based on 1 article reviews
    plasmid pgex 6p 1 brd4 full length - by Bioz Stars, 2026-05
    92/100 stars
      Buy from Supplier

    Image Search Results


    FIGURE 1 | Generation of a p300 construct with improved yield. (A) Representative expression and purification gel of p300 KAT from pETdu- et+p300 KAT suggests a total yield of ~1 mg/L of media. Lanes show (1) Whole cell lysate (2) Insoluble pellet (3) Soluble supernatant (4) NiNTA flowthrough (5) Low salt (150 mM) wash (6) High salt (1 M) wash (7) NiNTA elution alongside the protein standard ladder lane (L) (ThermoFischer 26 634). p300 KAT is the faint band ~50 kDa in lane 7. (B) Schematic representation of the histone H4 (1-25)W construct used in subsequent experi- ments. This construct can be uniformly acetylated by p300 KAT on each of its five available lysine sites. (C) Demonstration of variable activity be- tween p300 KAT preparations shown by MALDI-MS spectra of identical acetylation reactions using presumably equivalent enzyme preparations. (D) Representative expression and purification gel for p300 KAT from pET His6 MBP TEV p300(1284–1669) LIC (Addgene #233587). Total yield was typ- ically > 10 mg/L of media. Lanes show (1) Whole cell lysate (2) Insoluble pellet (3) Soluble supernatant (4) NiNTA flowthrough 1 (5) Low salt (150 mM) wash (6) High salt (1 M) wash (7) NiNTA elution 1 (8) TEV protease dialysate (9) NiNTA flowthrough 2 (10) NiNTA wash 2 (11) NiNTA elution 2 (12) Protein ladder (NEB P7719S). Cleaved p300 KAT is the band ~43 kDa in lanes 9 and 10 (expected molecular weight once cleaved is 44 684 Da). Note this is very close to the expected molecular weight of 41 584 Da for the cleaved MBP solubility tag.

    Journal: Proteins

    Article Title: Probing Enzymatic Acetylation Events in Real Time With NMR Spectroscopy: Insights Into Acyl-Cofactor Dependent p300 Modification of Histone H4.

    doi: 10.1002/prot.26848

    Figure Lengend Snippet: FIGURE 1 | Generation of a p300 construct with improved yield. (A) Representative expression and purification gel of p300 KAT from pETdu- et+p300 KAT suggests a total yield of ~1 mg/L of media. Lanes show (1) Whole cell lysate (2) Insoluble pellet (3) Soluble supernatant (4) NiNTA flowthrough (5) Low salt (150 mM) wash (6) High salt (1 M) wash (7) NiNTA elution alongside the protein standard ladder lane (L) (ThermoFischer 26 634). p300 KAT is the faint band ~50 kDa in lane 7. (B) Schematic representation of the histone H4 (1-25)W construct used in subsequent experi- ments. This construct can be uniformly acetylated by p300 KAT on each of its five available lysine sites. (C) Demonstration of variable activity be- tween p300 KAT preparations shown by MALDI-MS spectra of identical acetylation reactions using presumably equivalent enzyme preparations. (D) Representative expression and purification gel for p300 KAT from pET His6 MBP TEV p300(1284–1669) LIC (Addgene #233587). Total yield was typ- ically > 10 mg/L of media. Lanes show (1) Whole cell lysate (2) Insoluble pellet (3) Soluble supernatant (4) NiNTA flowthrough 1 (5) Low salt (150 mM) wash (6) High salt (1 M) wash (7) NiNTA elution 1 (8) TEV protease dialysate (9) NiNTA flowthrough 2 (10) NiNTA wash 2 (11) NiNTA elution 2 (12) Protein ladder (NEB P7719S). Cleaved p300 KAT is the band ~43 kDa in lanes 9 and 10 (expected molecular weight once cleaved is 44 684 Da). Note this is very close to the expected molecular weight of 41 584 Da for the cleaved MBP solubility tag.

    Article Snippet: p300 KAT was originally obtained from pETduet+p300 KAT, a gift from Michael Rosen (Addgene #157793), which coexpresses human p300 (1284–1664) with yeast Sirt2 [22].

    Techniques: Construct, Expressing, Purification, Activity Assay, Molecular Weight, Solubility

    FIGURE 2 | Pre-acetylation of p300 does not meaningfully alter acetyltransferase activity. (A) Overlaid 13C, 1H-HSQC NMR spectra showing re- action products after 1 h treatment of histone H4 (1-25)W with native p300 (teal) or p300 prescribed to a 2-h incubation with acetyl-CoA (purple). (B) overlaid 1D projections of the 13C, 1H-HSQC experiments demonstrate nearly equivalent peak heights for the acetyl-CoA (2.25 ppm) and acetyllysine (1.87 ppm 1H) products. (C) MALDI-MS spectra showing the distributions of reaction products.

    Journal: Proteins

    Article Title: Probing Enzymatic Acetylation Events in Real Time With NMR Spectroscopy: Insights Into Acyl-Cofactor Dependent p300 Modification of Histone H4.

    doi: 10.1002/prot.26848

    Figure Lengend Snippet: FIGURE 2 | Pre-acetylation of p300 does not meaningfully alter acetyltransferase activity. (A) Overlaid 13C, 1H-HSQC NMR spectra showing re- action products after 1 h treatment of histone H4 (1-25)W with native p300 (teal) or p300 prescribed to a 2-h incubation with acetyl-CoA (purple). (B) overlaid 1D projections of the 13C, 1H-HSQC experiments demonstrate nearly equivalent peak heights for the acetyl-CoA (2.25 ppm) and acetyllysine (1.87 ppm 1H) products. (C) MALDI-MS spectra showing the distributions of reaction products.

    Article Snippet: p300 KAT was originally obtained from pETduet+p300 KAT, a gift from Michael Rosen (Addgene #157793), which coexpresses human p300 (1284–1664) with yeast Sirt2 [22].

    Techniques: Activity Assay, Incubation

    FIGURE 3 | Comparison of p300 and p300Δ acetyltransferase activity towards the histone H4 tail. (A) Circular dichroism spectra for p300 (teal) and p300Δ (pink) used to estimate secondary structure content with BestSel. (B) MALDI-MS time courses comparing relative acetyltransferase ef- ficiency of p300 (teal) and p300Δ (pink) using the histone H4 tail as a substrate. (C) Mono-exponential fit of acetyltransferase reaction curves from a 1H-13C, HSQC based NMR time course for p300 (teal) and p300Δ (pink) acetyltransferase reactions with the histone H4 tail. Progress curves show the increase in intensity for the acetyllysine resonance centered at 1.86 ppm 1H, 22.1 ppm 13C over time, each data point represents the maximum acetyllysine peak intensity from a 3 min and 36 s experiment. Progress curves were fit with a mono-exponential kinetic model to estimate relative turnover rates (k) and maximum intensity (Imax). (D) Progress curves for p300 (teal) and p300Δ (pink) acetyltransferase reactions with the histone H4 tail fit with a bi-exponential kinetic model to estimate relative turnover rates (k1 and k2) and relative contributions to the maximum intensity (A1 and A2). R2 values are included in C and D to indicate the goodness of fit, and fit residuals for each data point are displayed at scale relative to 20% of the maximum data intensity.

    Journal: Proteins

    Article Title: Probing Enzymatic Acetylation Events in Real Time With NMR Spectroscopy: Insights Into Acyl-Cofactor Dependent p300 Modification of Histone H4.

    doi: 10.1002/prot.26848

    Figure Lengend Snippet: FIGURE 3 | Comparison of p300 and p300Δ acetyltransferase activity towards the histone H4 tail. (A) Circular dichroism spectra for p300 (teal) and p300Δ (pink) used to estimate secondary structure content with BestSel. (B) MALDI-MS time courses comparing relative acetyltransferase ef- ficiency of p300 (teal) and p300Δ (pink) using the histone H4 tail as a substrate. (C) Mono-exponential fit of acetyltransferase reaction curves from a 1H-13C, HSQC based NMR time course for p300 (teal) and p300Δ (pink) acetyltransferase reactions with the histone H4 tail. Progress curves show the increase in intensity for the acetyllysine resonance centered at 1.86 ppm 1H, 22.1 ppm 13C over time, each data point represents the maximum acetyllysine peak intensity from a 3 min and 36 s experiment. Progress curves were fit with a mono-exponential kinetic model to estimate relative turnover rates (k) and maximum intensity (Imax). (D) Progress curves for p300 (teal) and p300Δ (pink) acetyltransferase reactions with the histone H4 tail fit with a bi-exponential kinetic model to estimate relative turnover rates (k1 and k2) and relative contributions to the maximum intensity (A1 and A2). R2 values are included in C and D to indicate the goodness of fit, and fit residuals for each data point are displayed at scale relative to 20% of the maximum data intensity.

    Article Snippet: p300 KAT was originally obtained from pETduet+p300 KAT, a gift from Michael Rosen (Addgene #157793), which coexpresses human p300 (1284–1664) with yeast Sirt2 [22].

    Techniques: Comparison, Activity Assay, Circular Dichroism

    FIGURE 4 | Validation of 12C propionyl-CoA synthesis and con- trol reactions to enable 13C propionylation resonance assignments. (A) Proton 1D NMR spectra showing the reaction product of the propionyl- CoA (green) synthesis reaction from propionic anhydride precursor (gray). The peaks at 1.06 and 2.56 ppm, respectively, were assigned to the methyl and methylene protons of the CoA conjugated propionyl moiety based on comparison to reference proton 1D spectra provided by CoALA Biosciences (SKU PC01). (B) Overlaid 13C, 1H-HSQC NMR spectra of the propionyltransferase reaction mixture (without enzyme) before adding 13C propionyl-CoA (gray) and after adding 13C propionyl- CoA (green). (C) Overlaid 13C, 1H-HSQC NMR spectra for p300 cata- lyzed propionylation of the histone H4 tail (green) overlaid with the ap- propriate no enzyme control (gray).

    Journal: Proteins

    Article Title: Probing Enzymatic Acetylation Events in Real Time With NMR Spectroscopy: Insights Into Acyl-Cofactor Dependent p300 Modification of Histone H4.

    doi: 10.1002/prot.26848

    Figure Lengend Snippet: FIGURE 4 | Validation of 12C propionyl-CoA synthesis and con- trol reactions to enable 13C propionylation resonance assignments. (A) Proton 1D NMR spectra showing the reaction product of the propionyl- CoA (green) synthesis reaction from propionic anhydride precursor (gray). The peaks at 1.06 and 2.56 ppm, respectively, were assigned to the methyl and methylene protons of the CoA conjugated propionyl moiety based on comparison to reference proton 1D spectra provided by CoALA Biosciences (SKU PC01). (B) Overlaid 13C, 1H-HSQC NMR spectra of the propionyltransferase reaction mixture (without enzyme) before adding 13C propionyl-CoA (gray) and after adding 13C propionyl- CoA (green). (C) Overlaid 13C, 1H-HSQC NMR spectra for p300 cata- lyzed propionylation of the histone H4 tail (green) overlaid with the ap- propriate no enzyme control (gray).

    Article Snippet: p300 KAT was originally obtained from pETduet+p300 KAT, a gift from Michael Rosen (Addgene #157793), which coexpresses human p300 (1284–1664) with yeast Sirt2 [22].

    Techniques: Biomarker Discovery, Comparison, Control

    FIGURE 5 | Comparison of p300 and p300Δ propionyltransferase activity towards the histone H4 tail. (A) MALDI-MS time course com- paring relative propionyltransferase efficiency of p300 (teal) and p300Δ (pink) using the histone H4 tail as a substrate. (B) Progress curves for p300 (teal) and p300Δ (pink) propionyltransferase reactions with the histone H4 tail fit with a mono-exponential kinetic model to estimate relative turnover rates (k) and maximum intensity (Imax). (C) Progress curves for p300 (teal) and p300Δ (pink) propionyltransferase reactions with the histone H4 tail fit with a lagged mono-exponential kinetic model to estimate relative turnover rate (k1), amplitude (A), lag time (t0), and slope around t0 (α). R2 values are included in B and C to indicate the goodness of fit, and fit residuals for each data point are displayed at scale relative to 20% of the maximum data intensity.

    Journal: Proteins

    Article Title: Probing Enzymatic Acetylation Events in Real Time With NMR Spectroscopy: Insights Into Acyl-Cofactor Dependent p300 Modification of Histone H4.

    doi: 10.1002/prot.26848

    Figure Lengend Snippet: FIGURE 5 | Comparison of p300 and p300Δ propionyltransferase activity towards the histone H4 tail. (A) MALDI-MS time course com- paring relative propionyltransferase efficiency of p300 (teal) and p300Δ (pink) using the histone H4 tail as a substrate. (B) Progress curves for p300 (teal) and p300Δ (pink) propionyltransferase reactions with the histone H4 tail fit with a mono-exponential kinetic model to estimate relative turnover rates (k) and maximum intensity (Imax). (C) Progress curves for p300 (teal) and p300Δ (pink) propionyltransferase reactions with the histone H4 tail fit with a lagged mono-exponential kinetic model to estimate relative turnover rate (k1), amplitude (A), lag time (t0), and slope around t0 (α). R2 values are included in B and C to indicate the goodness of fit, and fit residuals for each data point are displayed at scale relative to 20% of the maximum data intensity.

    Article Snippet: p300 KAT was originally obtained from pETduet+p300 KAT, a gift from Michael Rosen (Addgene #157793), which coexpresses human p300 (1284–1664) with yeast Sirt2 [22].

    Techniques: Comparison, Activity Assay

    (a) Cryo-EM map and (b) cartoon representation of the BRD4-S/nucleosome complex showing how the BRD4 BD1 (pink) interacts with the nucleosome. The modeled histone H4 tail residues 11-16 are shown as a thicker gold line.

    Journal: bioRxiv

    Article Title: BRD4 binds the nucleosome via both histone and DNA interactions

    doi: 10.1101/2025.05.29.656846

    Figure Lengend Snippet: (a) Cryo-EM map and (b) cartoon representation of the BRD4-S/nucleosome complex showing how the BRD4 BD1 (pink) interacts with the nucleosome. The modeled histone H4 tail residues 11-16 are shown as a thicker gold line.

    Article Snippet: The coding region of the short isoform of human BRD4 (residues 1–722) was amplified from the plasmid pGEX-6P-1 BRD4 full-length (a gift from Peter Howley, AddGene plasmid #14447 ) and cloned into the pST50Tr-HISN expression vector .

    Techniques: Cryo-EM Sample Prep

    (a) representative motion-corrected micrographs, (b) representative 2D classes, (c) angular distribution of particles used to generate the cryo-EM map, (d) cryo-EM map of the BRD4/nucleosome complex colored by estimated local resolution determined with FSC = 0.143 cutoff in cryoSPARC, (e) conical Fourier shell correlation (cFSC) curve of the BRD4-nucleosome structure at 2.89 Å resolution, calculated between two independent half-maps using a conical mask with a specified half-angle and axis in Fourier space in cryoSPARC. Lines and arrows indicate the axis of rotation between successive views, (f) unmasked (red) and masked (blue) Fourier shell correlation (FSC) curves between two independent half-maps determined in cryoSPARC.

    Journal: bioRxiv

    Article Title: BRD4 binds the nucleosome via both histone and DNA interactions

    doi: 10.1101/2025.05.29.656846

    Figure Lengend Snippet: (a) representative motion-corrected micrographs, (b) representative 2D classes, (c) angular distribution of particles used to generate the cryo-EM map, (d) cryo-EM map of the BRD4/nucleosome complex colored by estimated local resolution determined with FSC = 0.143 cutoff in cryoSPARC, (e) conical Fourier shell correlation (cFSC) curve of the BRD4-nucleosome structure at 2.89 Å resolution, calculated between two independent half-maps using a conical mask with a specified half-angle and axis in Fourier space in cryoSPARC. Lines and arrows indicate the axis of rotation between successive views, (f) unmasked (red) and masked (blue) Fourier shell correlation (FSC) curves between two independent half-maps determined in cryoSPARC.

    Article Snippet: The coding region of the short isoform of human BRD4 (residues 1–722) was amplified from the plasmid pGEX-6P-1 BRD4 full-length (a gift from Peter Howley, AddGene plasmid #14447 ) and cloned into the pST50Tr-HISN expression vector .

    Techniques: Cryo-EM Sample Prep

    Schematic representation of the cryo-EM data processing pipeline for the BRD4/nucleosome complex, as described in the Methods section.

    Journal: bioRxiv

    Article Title: BRD4 binds the nucleosome via both histone and DNA interactions

    doi: 10.1101/2025.05.29.656846

    Figure Lengend Snippet: Schematic representation of the cryo-EM data processing pipeline for the BRD4/nucleosome complex, as described in the Methods section.

    Article Snippet: The coding region of the short isoform of human BRD4 (residues 1–722) was amplified from the plasmid pGEX-6P-1 BRD4 full-length (a gift from Peter Howley, AddGene plasmid #14447 ) and cloned into the pST50Tr-HISN expression vector .

    Techniques: Cryo-EM Sample Prep

    (a) cryo-EM map of viewed from the side to show interaction of histone H4 tail with BRD4 BD1, (b) cryo-EM map prepared from subset of particles shows extra density (purple) beyond the C-terminus of BRD4 BD1 (top view on left, side view on right).

    Journal: bioRxiv

    Article Title: BRD4 binds the nucleosome via both histone and DNA interactions

    doi: 10.1101/2025.05.29.656846

    Figure Lengend Snippet: (a) cryo-EM map of viewed from the side to show interaction of histone H4 tail with BRD4 BD1, (b) cryo-EM map prepared from subset of particles shows extra density (purple) beyond the C-terminus of BRD4 BD1 (top view on left, side view on right).

    Article Snippet: The coding region of the short isoform of human BRD4 (residues 1–722) was amplified from the plasmid pGEX-6P-1 BRD4 full-length (a gift from Peter Howley, AddGene plasmid #14447 ) and cloned into the pST50Tr-HISN expression vector .

    Techniques: Cryo-EM Sample Prep

    (a) Time-resolved FRET binding assay results for BRD4-S binding to unmodified (blue), H4 tailless = H4(24-102) (green) and H4 K12acK16ac nucleosomes (pink) in 70 mM NaCl. (b) Effect of NaCl concentration on BRD4-S binding to unmodified (blue) or H4 K12acK16ac nucleosomes (pink) as assayed by TR-FRET.

    Journal: bioRxiv

    Article Title: BRD4 binds the nucleosome via both histone and DNA interactions

    doi: 10.1101/2025.05.29.656846

    Figure Lengend Snippet: (a) Time-resolved FRET binding assay results for BRD4-S binding to unmodified (blue), H4 tailless = H4(24-102) (green) and H4 K12acK16ac nucleosomes (pink) in 70 mM NaCl. (b) Effect of NaCl concentration on BRD4-S binding to unmodified (blue) or H4 K12acK16ac nucleosomes (pink) as assayed by TR-FRET.

    Article Snippet: The coding region of the short isoform of human BRD4 (residues 1–722) was amplified from the plasmid pGEX-6P-1 BRD4 full-length (a gift from Peter Howley, AddGene plasmid #14447 ) and cloned into the pST50Tr-HISN expression vector .

    Techniques: Binding Assay, Concentration Assay

    (a) top: cartoon representation of BRD4 constructs, bottom: individual TR-FRET unnormalized fluorescence (not normalized to maximum fluorescence) binding results of for wild-type BRD4-S binding to H4 K12acK16ac nucleosomes and average of 3 measurements for BRD4 BD1 and BD2 binding to H4 K12acK16ac nucleosomes, (b) TR-FRET binding curves for BRD4-S binding to unmodified (blue) or H4 K12acK16ac (pink) nucleosomes in 100, 125 and 150 mM NaCl.

    Journal: bioRxiv

    Article Title: BRD4 binds the nucleosome via both histone and DNA interactions

    doi: 10.1101/2025.05.29.656846

    Figure Lengend Snippet: (a) top: cartoon representation of BRD4 constructs, bottom: individual TR-FRET unnormalized fluorescence (not normalized to maximum fluorescence) binding results of for wild-type BRD4-S binding to H4 K12acK16ac nucleosomes and average of 3 measurements for BRD4 BD1 and BD2 binding to H4 K12acK16ac nucleosomes, (b) TR-FRET binding curves for BRD4-S binding to unmodified (blue) or H4 K12acK16ac (pink) nucleosomes in 100, 125 and 150 mM NaCl.

    Article Snippet: The coding region of the short isoform of human BRD4 (residues 1–722) was amplified from the plasmid pGEX-6P-1 BRD4 full-length (a gift from Peter Howley, AddGene plasmid #14447 ) and cloned into the pST50Tr-HISN expression vector .

    Techniques: Construct, Fluorescence, Binding Assay

    (a) BRD4-S domains and basic patches highlighted in cartoon and primary sequence (left) and identity of BRD4-S basic patch mutations studied (right), (b) TR-FRET dissociation constants for BRD4-S basic patch mutants binding to H4 K12acK16ac nucleosomes in 70 mM NaCl, (c) TR-FRET dissociation constants for BRD4-S basic patch mutants binding to H4 K12acK16ac nucleosomes in 150 mM NaCl, (d) effect of salt concentration on select BRD4-S basic patch mutations on binding to H4 K12acK16ac nucleosomes.

    Journal: bioRxiv

    Article Title: BRD4 binds the nucleosome via both histone and DNA interactions

    doi: 10.1101/2025.05.29.656846

    Figure Lengend Snippet: (a) BRD4-S domains and basic patches highlighted in cartoon and primary sequence (left) and identity of BRD4-S basic patch mutations studied (right), (b) TR-FRET dissociation constants for BRD4-S basic patch mutants binding to H4 K12acK16ac nucleosomes in 70 mM NaCl, (c) TR-FRET dissociation constants for BRD4-S basic patch mutants binding to H4 K12acK16ac nucleosomes in 150 mM NaCl, (d) effect of salt concentration on select BRD4-S basic patch mutations on binding to H4 K12acK16ac nucleosomes.

    Article Snippet: The coding region of the short isoform of human BRD4 (residues 1–722) was amplified from the plasmid pGEX-6P-1 BRD4 full-length (a gift from Peter Howley, AddGene plasmid #14447 ) and cloned into the pST50Tr-HISN expression vector .

    Techniques: Sequencing, Binding Assay, Concentration Assay

    Journal: bioRxiv

    Article Title: BRD4 binds the nucleosome via both histone and DNA interactions

    doi: 10.1101/2025.05.29.656846

    Figure Lengend Snippet:

    Article Snippet: The coding region of the short isoform of human BRD4 (residues 1–722) was amplified from the plasmid pGEX-6P-1 BRD4 full-length (a gift from Peter Howley, AddGene plasmid #14447 ) and cloned into the pST50Tr-HISN expression vector .

    Techniques:

    (a) BRD4 BD1 interactions with the nucleosome with key regions highlighted, (b) TR-FRET dissociation constants for BRD4-S bromodomain mutants binding to H4 K12acK16ac nucleosomes, (c) model for how BRD4 basic region 1 could interact with nucleosome DNA minor groove with C ⍺ positions of the 5 basic residues shown in blue spheres, (d) effect of BRD4-S BD1 mutations on BRD4-S/nucleosome complex mobility in gel mobility shift assay, (e) NMR structure of HMG-I(Y) AT-hook Arg-Gly-Arg region binding to DNA (PDB ID 2EZD), protein residues outside of the Arg-Gly-Arg region not shown, (f) TR-FRET dissociation constants for BRD4-S basic patch 1 mutants binding to H4 K12acK16ac nucleosomes.

    Journal: bioRxiv

    Article Title: BRD4 binds the nucleosome via both histone and DNA interactions

    doi: 10.1101/2025.05.29.656846

    Figure Lengend Snippet: (a) BRD4 BD1 interactions with the nucleosome with key regions highlighted, (b) TR-FRET dissociation constants for BRD4-S bromodomain mutants binding to H4 K12acK16ac nucleosomes, (c) model for how BRD4 basic region 1 could interact with nucleosome DNA minor groove with C ⍺ positions of the 5 basic residues shown in blue spheres, (d) effect of BRD4-S BD1 mutations on BRD4-S/nucleosome complex mobility in gel mobility shift assay, (e) NMR structure of HMG-I(Y) AT-hook Arg-Gly-Arg region binding to DNA (PDB ID 2EZD), protein residues outside of the Arg-Gly-Arg region not shown, (f) TR-FRET dissociation constants for BRD4-S basic patch 1 mutants binding to H4 K12acK16ac nucleosomes.

    Article Snippet: The coding region of the short isoform of human BRD4 (residues 1–722) was amplified from the plasmid pGEX-6P-1 BRD4 full-length (a gift from Peter Howley, AddGene plasmid #14447 ) and cloned into the pST50Tr-HISN expression vector .

    Techniques: Binding Assay, Mobility Shift

    Acidic patch nucleosomes contain the H2A(E61A,E64A,D90A,E92A) quadruple mutation. BRD4-S binds wild-type nucleosomes (blue) and acidic patch nucleosomes (red) with similar affinity, but the RCC1 chromatin factor shown to use an arginine anchor to bind to the nucleosome acidic patch is adversely affected by the nucleosome acidic patch mutations.

    Journal: bioRxiv

    Article Title: BRD4 binds the nucleosome via both histone and DNA interactions

    doi: 10.1101/2025.05.29.656846

    Figure Lengend Snippet: Acidic patch nucleosomes contain the H2A(E61A,E64A,D90A,E92A) quadruple mutation. BRD4-S binds wild-type nucleosomes (blue) and acidic patch nucleosomes (red) with similar affinity, but the RCC1 chromatin factor shown to use an arginine anchor to bind to the nucleosome acidic patch is adversely affected by the nucleosome acidic patch mutations.

    Article Snippet: The coding region of the short isoform of human BRD4 (residues 1–722) was amplified from the plasmid pGEX-6P-1 BRD4 full-length (a gift from Peter Howley, AddGene plasmid #14447 ) and cloned into the pST50Tr-HISN expression vector .

    Techniques: Mutagenesis

    (a) the BRD4-S m12/H4 K12acK16ac nucleosome complex (blue) elutes earlier than the BRD4-S WT/H4 K12acK16ac nucleosome complex, (b) the BRD4-S m12 protein elutes at similar time as the BRD4 WT protein.

    Journal: bioRxiv

    Article Title: BRD4 binds the nucleosome via both histone and DNA interactions

    doi: 10.1101/2025.05.29.656846

    Figure Lengend Snippet: (a) the BRD4-S m12/H4 K12acK16ac nucleosome complex (blue) elutes earlier than the BRD4-S WT/H4 K12acK16ac nucleosome complex, (b) the BRD4-S m12 protein elutes at similar time as the BRD4 WT protein.

    Article Snippet: The coding region of the short isoform of human BRD4 (residues 1–722) was amplified from the plasmid pGEX-6P-1 BRD4 full-length (a gift from Peter Howley, AddGene plasmid #14447 ) and cloned into the pST50Tr-HISN expression vector .

    Techniques:

    The BRD4 residues R68, K72, K76 observed to interact with nucleosomal DNA and the BRD2, BRD3 and BRDT equivalent BD1 and BD2 residues are highlighted in yellow.

    Journal: bioRxiv

    Article Title: BRD4 binds the nucleosome via both histone and DNA interactions

    doi: 10.1101/2025.05.29.656846

    Figure Lengend Snippet: The BRD4 residues R68, K72, K76 observed to interact with nucleosomal DNA and the BRD2, BRD3 and BRDT equivalent BD1 and BD2 residues are highlighted in yellow.

    Article Snippet: The coding region of the short isoform of human BRD4 (residues 1–722) was amplified from the plasmid pGEX-6P-1 BRD4 full-length (a gift from Peter Howley, AddGene plasmid #14447 ) and cloned into the pST50Tr-HISN expression vector .

    Techniques:

    Superposition of ZL0590/BRD4 BD1 crystal structure (PDB 6U0D) with BRD4/nucleosome structure (this work) via BRD4 BD1.

    Journal: bioRxiv

    Article Title: BRD4 binds the nucleosome via both histone and DNA interactions

    doi: 10.1101/2025.05.29.656846

    Figure Lengend Snippet: Superposition of ZL0590/BRD4 BD1 crystal structure (PDB 6U0D) with BRD4/nucleosome structure (this work) via BRD4 BD1.

    Article Snippet: The coding region of the short isoform of human BRD4 (residues 1–722) was amplified from the plasmid pGEX-6P-1 BRD4 full-length (a gift from Peter Howley, AddGene plasmid #14447 ) and cloned into the pST50Tr-HISN expression vector .

    Techniques: